Skip to main content

Table 1 Primers used for SNP identification of fTNFA and fCD209 gene

From: Polymorphisms in the feline TNFA and CD209 genes are associated with the outcome of feline coronavirus infection

Target gene/region Positiona Orientationb Sequence (5′ - 3′) TAc Amplicon size
fTNFA/5′-PRRd −847 to −827 F GAATTCCCAGGGTTGCTTTCA 65 °C 1018 bp
  +171 to +153 R GCCGATCACTCCAAAGTGC   
fCD209/5′-PRR −1057 to −1038 F GAAGCGGGCTTCTTGTTGAC 65 °C 1076 bp
  +19 to +1 R GCTCCTTGGGGTCACACAT   
fCD209/ECDe +1818 to +1838 F CCAAGATCTGATGCATCTGCT 67 °C 1350 bp
  +3168 to +3149 R ATGAGCTCGTTGCCTGATCT   
  1. aThe nucleotide positions are numerated from the translation start point (+1).
  2. bF: forward; R: reverse.
  3. cAnnealing temperature.
  4. d5′-proximal regulatory region.
  5. eExtracellular domain.