Skip to main content

Table 1 Primer and probe sequences for quantitative reverse transcription PCR assays

From: Highly pathogenic avian influenza virus infection in chickens but not ducks is associated with elevated host immune and pro-inflammatory responses

Gene GenBank acc. No Primer sequence Probe sequence
Chicken
18S rRNA AF173612.1 Fwd :TGTGCCGCTAGAGGTGAAATT 5′ (6FAM) TTGGACCGGCGCAAGACGAAC 3′ (TAMRA)
Rev: TGGCAAATGCTTTCGCTTT
IL-6 EU170468 Fwd :CACGATCCGGCAGATGGT 5′ (6FAM)ATAAATCCCGATGAAGTGGTCATCC 3′ (TAMRA)
Rev: TGGGCGGCCGAGTCT
IL-8 /CXCLi1(K60) NM_205018.1 Fwd :CCCTCGCCACAGAACCAA 5′ (6FAM)CCCAGGTGACACCCGGAAGAAACA 3′ (TAMRA)
Rev: CAGCCTTGCCCATCATCTTT
IFN-α EU367971 Fwd :CTTCCTCCAAGACAACGATTACAG 5′ (6FAM)CCTGCGCCTGGGAACACGTCC 3′ (TAMRA)
Rev: AGGAACCAGGCACGAGCTT
LITAF AY765397 Fwd :CCCTTCTGAGGCATTTGGAA  
Rev: CAGCCTGCAAATTTTGTCTTCTT
STAT-3 NM_001030931.1 Fwd: TGGGTGGAGAAGGACATCA  
Rev: CATGGGCAGGTCAATGGTAT
Duck
Duck IL-6 AB191038 Fwd :CCAAGGTGACGGAGGAAGAC 5′ (6FAM)TGTCTCCTGGCTGGCTTCGACGA 3′ (TAMRA)
Rev: TGGAGAGTTTCTTCAAGCATTTCTC
Duck IL-8 AB236334.1 Fwd :AGCCTGGTAAGGATGGGAAAC 5′ (6FAM)AGCTCCGGTGCCAGTGCATAAGCA 3′ (TAMRA)
Rev: GGGTGGATGAACTTCGAGTGA
Duck IFN-α DQ861429 Fwd :AACCAGCTTCAGCACCACATC 5′ (6FAM)TGCTTCCCAGCCGACGCC 3′ (TAMRA)
Rev: TGTGGTTCTGGAGGAAGTGTTG