Skip to main content

Advertisement

Table 1 Oligonucleotides used in this study

From: First identification of proteins involved in motility of Mycoplasma gallisepticum

Primer Sequence (5′ to 3′) Product (length [bp])
Ad1B CTCGTAGACTGCGTACC LM-PCR (variable)
Ad2B GATCGGTACGCAGTCTAC
C’gapA5 ATTAggatccAGTATTCAACGTTTCTAAG MG gapA (911 bp)
C’gapA3 TACGaagcttACCTTAATTATTCAATTTTC
HisC-f GATCCCTCGAGCCCGGGGCATGCCATCATCATCATCATCATTAATAGGG synthetic 6xHis-tag
HisC-r CGCCCTATTAATGATGATGATGATGATGGCATGCCCCGGGCTCGA
ISL-f TATAccgcggATAAAGTCCGTATAATTGTG IS256L (1365 bp)
ISL-r TATAccgcggATAAAGTCCGTATAATTGTG
ISR-f TATAacgcgtGATAAAGTCCGTATAATTGTG IS256R (1342 bp)
ISR-r ATTggcccgAAAATAATAAAGGAAGTGAGTC
ISM-mgcF ATAAggatccTGTTGAAAAGCGCTTAGC MG mgc2
ISM-mgcR TTAAgcatgcTCTAGGTCCATTTTGTGG (1001)
Bgl TAGACTGCGTACCGATC LM-PCR
IS-I TGTACCGTAAAAGGACTG products
IS-N AAAGGACTGTTATATGGC (variable)
mgc2_3 ACGCAGgaattcATAACAATTATG MG mgc2
mgc2_4 TTTACAaagcttGTCTTATCTAGG (894)
mgc_tga GAAAGATTACCTCCGAACCATGGTTTTATCCAGTAGTGGG TGA > TGG
Xcat5 TAGATGggatccATGGAGAAAAAAATCACTG pACYC184 (751)
Xcat3 ATAAATggcgccCGCTTATTATCACTTATTC Cm PO + CmR