TCRBV amplifications1 | IGHV amplifications2 |
---|
No.: | Primer: | Sequence: | No.: | Primer: | Sequence |
---|
1 | VβI | tccatgctcttctgctgtgt | 10 | FR1-5 | gaggagaagctggtggagt |
2 | VβIV | kgcaycgggstkctctg | 11 | FR1-3 | ctcctgtgtcggctctgga |
3 | VβVII | ctcascggramcctttgc | 12 | FR3 | tgagaaccgaagacacggc |
4 | FR3βIa | gactchgchstgtwyytctgtg | 13 | α-Cμ | gggacgaagatgttcaagac |
5 | FR3βIb | crgacatctvkrtayytstgtg | 14 | α-Cδ | gctgggagctgccgagat |
6 | FR3βIV | gactcsgcygtgtatctctg | 15 | α-Cγ | ccgtccacgtaccaggagaa |
7 | FR3βVII | gactcrgccacctacstctg | 16 | α-Cα | gagcccaggagcaggtct |
8 | α-Cβ1 | tctccgcttccgatggttca | 17 | α-Cε | gtccggatggtggtgtttg |
9 | α-Cβ2 | gtggtctcacctgctgcag | 18 | α-JH | tgaggacacgacgacttcaa |
- 1Following primer pairs (stated in brackets for 1st, 2nd and 3rd PCR respectively) were used for TCRBV amplifications: VβI-VβIII families (1/8, 1/9, 4 + 5/9), VβIV-VβVI families (2/8, 2/9, 6/9) and VβVII family (3/8, 3/9, 7/9). Annealing temperatures (Tm) were 54 °C for 1st PCR, 61 °C for 2nd PCR and 55 °C for 3rd PCR.
- 2Following primer pairs (stated in brackets for 1st, 2nd and 3rd PCR respectively) were used for IGHV amplifications: total immunoglobulins (10/18, 11/18, 12/18), IgM (10/13, 11/13, 12/18), IgD (10/14, 11/14, 12/18), IgG (10/15, 11/15, 12/18), IgA (10/16, 11/16, 12/18) and IgE (10/17, 11/17, 12/18). Annealing temperatures (Tm) were 58 °C for 1st and 2nd PCR and 55 °C for 3rd PCR.