Skip to main content

Table 1 List of primers used in this study

From: The comparative profile of lymphoid cells and the T and B cell spectratype of germ-free piglets infected with viruses SIV, PRRSV or PCV2

TCRBV amplifications1 IGHV amplifications2
No.: Primer: Sequence: No.: Primer: Sequence
1 VβI tccatgctcttctgctgtgt 10 FR1-5 gaggagaagctggtggagt
2 VβIV kgcaycgggstkctctg 11 FR1-3 ctcctgtgtcggctctgga
3 VβVII ctcascggramcctttgc 12 FR3 tgagaaccgaagacacggc
4 FR3βIa gactchgchstgtwyytctgtg 13 α-Cμ gggacgaagatgttcaagac
5 FR3βIb crgacatctvkrtayytstgtg 14 α-Cδ gctgggagctgccgagat
6 FR3βIV gactcsgcygtgtatctctg 15 α-Cγ ccgtccacgtaccaggagaa
7 FR3βVII gactcrgccacctacstctg 16 α-Cα gagcccaggagcaggtct
8 α-Cβ1 tctccgcttccgatggttca 17 α-Cε gtccggatggtggtgtttg
9 α-Cβ2 gtggtctcacctgctgcag 18 α-JH tgaggacacgacgacttcaa
  1. 1Following primer pairs (stated in brackets for 1st, 2nd and 3rd PCR respectively) were used for TCRBV amplifications: VβI-VβIII families (1/8, 1/9, 4 + 5/9), VβIV-VβVI families (2/8, 2/9, 6/9) and VβVII family (3/8, 3/9, 7/9). Annealing temperatures (Tm) were 54 °C for 1st PCR, 61 °C for 2nd PCR and 55 °C for 3rd PCR.
  2. 2Following primer pairs (stated in brackets for 1st, 2nd and 3rd PCR respectively) were used for IGHV amplifications: total immunoglobulins (10/18, 11/18, 12/18), IgM (10/13, 11/13, 12/18), IgD (10/14, 11/14, 12/18), IgG (10/15, 11/15, 12/18), IgA (10/16, 11/16, 12/18) and IgE (10/17, 11/17, 12/18). Annealing temperatures (Tm) were 58 °C for 1st and 2nd PCR and 55 °C for 3rd PCR.