Skip to main content

Table 1 Ferret-specific gene primers with publication sources or database names and accession numbers

From: Heterogeneous pathological outcomes after experimental pH1N1 influenza infection in ferrets correlate with viral replication and host immune responses in the lung

Gene Primer Sequence (5'- 3') Publication source or NCBI accession n°
pH1N1 (2009) M + 25 F:AGATGAGTCTTCTAACCGAGGTCG R:TGCAAAGACACTTTCCAGTCTCTG [27]
M-124 human09
M + 64: Probe:FAMa-TCAGGCCCCCTCAAAGCCGA-TAMRAb
IFNα F:TCTCCATGTGACAAACCAGAAGA [31]
R:CAGAAAGTCCTGAGCACAATTCC
IFNγ F: TCAAAGTGATGAATGATCTCTCACC °
R: GCCGGGAAACACACTGTGAC
TNFα F: CCAGATGGCCTCCAACTAATCA °
R: GGCTTGTCACTTGGAGTTCGA
IL-6 F: AGTGGCTGAAACACGTAACAATTC °
R: ATGGCCCTCAGGCTGAACT
CCL5 F: GCTGCTTTGCCTACATTTCC °
R: CCCATTTCTTCTGTGGGTTG
CXCL8 F: AAGCAGGAAAACTGCCAAGAGA °
R: GCCAGAAGAAACCTGACCAAAG
CXCL10 F: CTTTGAACCAAAGTGCTGTTCTTATC °
R: GCGTGTAGTTCTAGAGAGAGGTACTC
TLR3 F: GATGACCTCCCAGCAAACAT °
R: GCACAATTCTGGCTCCAGTT
CCL2 F:GCTCCCTATTCACTTGCTGTTTC [55]
R:GATTCGATAGCCCTCCAGCTT
β-actin F: GCAGGTCATCACCATCG [Genbank: AF038150]
R: TGGAGTTGAAGGTGGTCT
IL-1α F: GGGAAACTACCTCATGGC [Genbank:JP011578]
R: TAGAGTCACAGGAAATTTAGAATCTT
CCL3 F: GGTCTTCTCTGCACCAT [Genbank:JP007133]
R: CCAGGCTTGGAGCATTG
CASP8 F: TTATGACTTTAGCATAGCACGGA [Genbank:JP006891]
R: GTCTCTGAAAGGCACGAT
BAX F: CTGGACAGTAACATGGAGTTACA [Genbank:JP006358]
R: CAAAGTAGAAGAGGGCAACGA
  1. aFAM, 6-carboxylfluorescein.
  2. bTAMRA, 6-carboxyltetramethyl rhodamine.