Skip to main content

Table 2 Quantitative real-time PCR primers used in this study

From: Duck MDA5 functions in innate immunity against H5N1 highly pathogenic avian influenza virus infections

Primer name Sequence of Oligonucleotide (5′ → 3′) Purpose
qdMDA5-f GCTACAGAAGATAGAAGTGTCA qRT-PCR
qdMDA5-r CAGGATCAGATCTGGTTCAG  
qdRIG-I-f GCTACCGCCGCTACATCGAG qRT-PCR
qdRIG-I-r TGCCAGTCCTGTGTAACCTG  
qdLGP2-f GTGGTGGAGCTGGAGAAGAG qRT-PCR
qdLGP2-r CCCTGTTCTCCTCAAAGGTG  
qdMx-f TGCTGTCCTTCATGACTTCG qRT-PCR
qdMx-r GCTTTGCTGAGCCGATTAAC  
qdPKR-f AATTCCTTGCCTTTTCATTCAA qRT-PCR
qdPKR-r TTTGTTTTGTGCCATATCTTGG  
qdOAS-f TCTTCCTCAGCTGCTTCTCC qRT-PCR
qdOAS-r ACTTCGATGGACTCGCTGTT  
qdIL-1β-f TCATCTTCTACCGCCTGGAC qRT-PCR
qdIL-1β-r GTAGGTGGCGATGTTGACCT  
qdIL-2-f GCCAAGAGCTGACCAACTTC qRT-PCR
qdIL-2-r ATCGCCCACACTAAGAGCAT  
qdIL-6-f TTCGACGAGGAGAAATGCTT qRT-PCR
qdIL-6-r CCTTATCGTCGTTGCCAGAT  
qdIL-8-f AAGTTCATCCACCCTAAATC qRT-PCR
qdIL-8-r GCATCAGAATTGAGCTGAGC  
qdIFN-α-f TCCTCCAACACCTCTTCGAC qRT-PCR
qdIFN-α-r GGGCTGTAGGTGTGGTTCTG  
qdIFN-γ-f GCTGATGGCAATCCTGTTTT qRT-PCR
qdIFN-γ-r GGATTTTCAAGCCAGTCAGC  
qdGAPDH-f ATGTTCGTGATGGGTGTGAA qRT-PCR
qdGAPDH-r CTGTCTTCGTGTGTGGCTGT  
  1. Note: qRT-PCR = quantitative real-time polymerase chain reaction. f = forward primer; r = reverse primer.