Skip to main content

Table 1 Gene cloning PCR primers used in this study

From: Duck MDA5 functions in innate immunity against H5N1 highly pathogenic avian influenza virus infections

Primer name Sequence of Oligonucleotide (5′ → 3′) Purpose
idMDA5-f AGRSMTTACCARATGGAAGTKG Gene cloning
idMDA5-r AARTGTTCTGCACARACRCGWTC  
idPKR-f CACCTAATTTTGATAATGCAAGAAA Gene cloning
idPKR-r ATAAATGTCTACTTCCTTTCCATA  
idOASL-f TTCCTCAAGGAGCGCTGCTTC Gene cloning
idOASL-r GGGTCGGCGGGATCCAGGAT  
5rdM5r-1 AATGAGATTTTCAGCTGAGAATCACCAC 5′-Race
5rdM5r-2 TGATCTTTGGTAATGTAAACAG  
3rdM5f-1 GATCTCAGCCATATGAACAGTGGGTG 3′-Race
3rdM5f-2 TGATGATGATGATGAACCAGC  
dMDA5-f ATGTCGACGGAGTGCCGAGACG Site mutation
dMDA5-site mutation-r AGGTGCTCTCATCAGCACGAGCTCGAC  
dMDA5-site mutation-f GCCCGTGGTCGAGCTCGTGCTGATGAG Site mutation
dMDA5-r TCAGTCTTCATCACTTGAAGGACA  
pCAGGS-MDA5-f TAACTCGAG ACCATGTCGACGGAGTGCCGAGACG MDA5 cloning
pCAGGS-MDA5-r ATTGCTAGC TCACTTGTCATCGTCGTCCTTGTAGTCATCTTCATCACTTGA  
pCAGGS-MDA5ΔRD-f TAACTCGAG ACCATGTCGACGGAGTGCCGAGACG MDA5-ΔRD cloning
pCAGGS-MDA5ΔRD-r ATTGCTAGC TCACTTGTCATCGTCGTCCTTGTAGTCAGGGTTTTTCTTATATG  
pCAGGS-MDA5ΔCARD-f TAACTCGAG ACCATGACAGGAGGAAAAGAGAATAA MDA5-ΔCARD cloning
pCAGGS-MDA5ΔCARD-r ATTGCTAGC TCACTTGTCATCGTCGTCCTTGTAGTCATCTTCATCACTTGA  
pCAGGS-MDA5ΔCARD + ΔRD-f TAACTCGAG ACCATGACAGGAGGAAAAGAGAATAA MDA5ΔCARD + ΔRD cloning
pCAGGS-MDA5ΔCARD + ΔRD-r ATTGCTAGC TCACTTGTCATCGTCGTCCTTGTAGTCAGGGTTTTTCTTATATG  
pCAGGS-MDA5-CARD -f TAACTCGAG ACCATGTCGACGGAGTGCCGAGACG MDA5-CARD cloning
pCAGGS-MDA5-CARD -r ATTGCTAGC TCACTTGTCATCGTCGTCCTTGTAGTCATTTCCACTTAAATCAT  
pCAGGS-DK212-NS1-f TAACTCGAG ACCATGGATTCCAACACTGT DK212-NS1 cloning
pCAGGS-DK212-NS1-r ATTGCTAGC TCACTTGTCATCGTCGTCCTTGTAGTCAACTTTTGACTCAAT  
  1. Note: CGTCTC was the recognition site of restriction enzyme Xho I and GCTAGC was the recognition site of restriction enzyme Nhe I. R = A/G, S = C/G, M = A/C, K = G/T, W = A/T. f = forward primer; r = reverse primer.