Skip to main content

Table 1 Primer sequences, annealing temperatures of primer sets (°C), expected PCR fragment sizes (bp) and accession numbers or references

From: Innate immune response to a H3N2 subtype swine influenza virus in newborn porcine trachea cells, alveolar macrophages, and precision-cut lung slices

Primer name Primer sequence Annealing temperature (s) (°C) PCR product (bp) Accession number or reference
ActB CACGCCATCCTGCGTCTGGA 63 100 [38]
Beta actin AGCACCGTGTTGGCGTAGAG
B2MI CAAGATAGTTAAGTGGGATCGAGAC 58 161 [38]
Beta-2-microgobulin TGGTAACATCAATACGATTTCTGA
CISH GGGAATCTGGCTGGTATTGG 62 126 BE014034
Cytokine-inducible SH2-containing protein CCGACAGTGTGAACAGGTAG
GAPDH CTTCACGACCATGGAGAAGG 63 170 AF017079
Glyceraldehyde-3-phosphate dehydrogenase CCAAGCAGTTGGTGGTACAG
HMBS-2 AGGATGGGCAACTCTACCTG 58 83 [38]
Hydroxymethylbilane synthase 2 GATGGTGGCCTGCATAGTCT
HPRT-1 GGACTTGAATCATGTTTGTG 60 91 [38]
Hypoxanthine phosphoribosyltransferase 1 CAGATGTTTCCAAACTCAAC
IL-1β AGAAGAGCCCATCGTCCTTG 62 139 NM_001005149
Interleukine 1 beta GAGAGCCTTCAGCTCATGTG
IL-6 ATCAGGAGACCTGCTTGATG 62 177 NM_214399
Interleukine 6 TGGTGGCTTTGTCTGGATTC
IL-8 TCCTGCTTTCTGCAGCTCTC 62 100 NM_213867
Interleukine 8 GGGTGGAAAGGTGTGGAATG
IFNα (1-17) GGCTCTGGTGCATGAGATGC 64 197 [39]
Interferon alpha (Type I) CAGCCAGGATGGAGTCCTCC
IFNβ ATGTCAGAAGCTCCTGGGACAGTT 62 246 [39]
Interferon beta (Type I) AGGTCATCCATCTGCCCATCAAGT
IFNγ GCTCTGGGAAACTGAATGAC 60 167 NM_213948
Interferon gamma (Type II) TCTCTGGCCTTGGAACATAG
IFNλ1/IL-29A GAGGCTGAGCTAGACTTGAC 60 115 NM_001142837
Interferon lambda1 (Type III) CCTGAAGTTCGACGTGGATG
IFNλ3/IL-28B GGCTCCTTGGCGAACTCATC 62 173 GQ996936
Interferon lambda3 (Type III) TCCTTCTTCTGGGCCTCCTG
iNOS GAGAGGCAGAGGCTTGAGAC 62 178 BI344008
Inducible nitric oxide synthase TGGAGGAGCTGATGGAGTAG
Mx1 AGTGTCGGCTGTTTACCAAG 60 151 NM_214061
Myxovirus resistance 1 TTCACAAACCCTGGCAACTC
Mx2 CCGACTTCAGTTCAGGATGG 62 156 AB258432
Myxovirus resistance 2 ACAGGAGACGGTCCGTTTAC
OAS1 CCCTGTTCGCGTCTCCAAAG 64 303 NM_214303
2′-5′-Oligoadenylate synthetase 1 GCGGGCAGGACATCAAACTC
SIV M protein AGATGAGTCTTCTAACCGAGGTCG 62 100 [40]
TGCAAAAACATCTTCAAGTCTCTG
PKR GACATCCAAAGCAGCTCTCC 62 365 NM_214319
Protein Kinase RNA-dependent CGCTCTACCTTCTCGCAATC
RPL-19 AACTCCCGTCAGCAGATCC 60 147 [41]
Ribosomal protein L19 AGTACCCTTCCGCTTACCG
RIG-I CGACATTGCTCAGTGCAATC 60 126 NM_213804
Retinoic acid-inducible gene I TCAGCGTTAGCAGTCAGAAG
SDHA CTACAAGGGGCAGGTTCTGA 58 141 [38]
Succinate dehydrogenase complex subunit A AAGACAACGAGGTCCAGGAG
SOCS1 CGCCCTCAGTGTGAAGATGG 62 110 EW101597
Suppressor of cytokine signaling 1 GCTCGAAGAGGCAGTCGAAG
SOCS3 CAGCTCCAAGAGCGAGTACC 61 179 NM_001123196
Suppressor of cytokine signaling 3 TGACGCTGAGCGTGAAGAGG
TBP-1 AACAGTTCAGTAGTTATGAGCCAGA 60 153 [38]
TATA box binding protein 1 AGATGTTCTCAAACGCTTCG
TLR3 CCTGCATTCCAGAAGTTGAG 60 152 NM_001097444
Toll Like Receptor 3 TGAGGTGGAGTATTGCAGAG
TLR7 TCAGCTACAACCAGCTGAAG 60 140 NM_001097434
Toll Like Receptor 7 CAGATGTCGCAACTGGAAAG
TLR8 AGCGCGGGAGGAGTATTGTG 62 118 NM_214187
Toll Like Receptor 8 GCCAGGGCAGCCAACATAAC
TNFα CCAATGGCAGAGTGGGTATG 62 116 X54859
Tumor Necrosis Factor alpha TGAAGAGGACCTGGGAGTAG
  1. Reference genes are in italic.