Skip to main content

Table 1 Primers used in this study

From: Edwardsiella tarda Hfq: impact on host infection and global protein expression

Primer Sequences (5′ → 3′)a
F1 ATGGCTAAGGGGCAATCT
R1 TTATTCAGCGTCATCACTGC
F2 GGATCC GGATTGATCCGGTCGCC (BamHI)
R2 CTGCCTGCTTGCCCCTTAGCCATTCT
F3 GGCAAGCAGGCAGCAGCTACCA
R3 GGATCC CGGTCGGTCTCCAACTG (BamHI)
F4 GATATC ATGGCTAAGGGGCAATC (EcoRV)
R4 GATATC TTCAGCGTCATCACTGC (EcoRV)
HP1-F CCCGGG ATGCGAGCTGAAACCATTCTG (SmaI)
HP1-R CCCGGG TTTTAAGCATGATGCGCT (SmaI)
HP2-F TACGTA ATGCTGATAATGCAAATATCAACT (SnaBI)
HP2-R TACGTA CAGGTGCGCGTTAAACCACG (SnaBI)
DPFP-F GATATC ATGTCTCAGCCTCAGAGCG (EcoRV)
DPFP-R GATATC CAGCGTCAGCAAACGCGT (EcoRV)
  1. aItalicized nucleotides are restriction sites of the enzymes indicated in the brackets at the ends.