Skip to main content

Table 2 Primers used in this study

From: Only one of the two type VI secretion systems encoded in the Salmonella enterica serotype Dublin genome is involved in colonization of the avian and murine hosts

Primer Sequencea
Mutagenesis  
SPI-6_T6SS_(H1 + P1) AGGGTGTTTTTATACATCCTGTGAAGTAAAAAAAACCGTAGTGTAGGCTGGAGCTGCTTC
SPI-6_T6SS_(H2 + P2) GTGAACATGGCACATTAATTTGAAGCAGCTCTCATCCGGTCATATGAATATCCTCCTTAG
SPI-6_OUT5 CCGAAGTGTATCTGGCGATGA
SD_∆phoN _(H1 + P1) GTGAGTCTTTATGAAAAGTCGTTATTTAGTATTTTTTCTAGTGTAGGCTGGAGCTGCTTC
SD_∆phoN _(H2 + P2) ACTTTCACCTTCAGTAATTAAGTTCGGGGTGATCTTCTTTCATATGAATATCCTCCTTAG
SD_∆phoN _OUT5 TTGCCTGATCCGGAGTGA
K1 CAGTCATAGCCGAATAGCCT
C3 CAGCTGAACGGTCTGGTTATAGG
VEX Capture  
SeD_A0289_VEX_H1_U1 TTAACCGGGATCGGGACATGTTCAGCGCAGAAGCAGACTGGGCCACGTGGGCCGTGCACCTTAAGCTT
SeD_A0289_VEX_H2_U2 GAGGTTATTCATGTCAACAGGATTACGTTTCACACTGGAGGTGCAGGCTGGAGCTGCTTC
SeD_A0326_VEX_H1_D1 GGGGAGGTTGTGCGACGTTTGCATAATCCAGCAAGAACTGGGTTTAACGGTTGTGGACAACAAGCCAGGG
SeD_A0326_VEX_H2_D2 ACACAGGCCAGACTGATTATACAGGCATGAAAAAGCTCTCCAGGTCGACGTCCCATGGCCATTCGAATTC
SD_VC_OUT5 GCTCTAGA CCGGAGGGGTTATCTTTTCC
SD_VC_OUT3 GCTCTAGA TTGAAGCAGCTCTCATCCGG
5trfA ACGTCCTTGTTGACGTGGAAAATGACCTTG
3trfA CCGGAAGGCATACAGGCAAGAACTGATCG
SPI-6_OUT_DOWN AAACGGGTCTATTTACAGGGGCAC
Tiling-PCR  
1_T6SS_SPI-6_FOR TTCAAGAAGTTCCACCGTCTATCG
1_T6SS_SPI-6_REV ACCTGTTTGAGCTGCTACATACCAG
2_T6SS_SPI-6_FOR CATTCAGTTCGCCGTCAAAGTG
2_T6SS_SPI-6_REV CCGCTGCGAATTTTGTTATCG
3_T6SS_SPI-6_FOR CCACGTTCTTCGGCATTACCAG
3_T6SS_SPI-6_REV CGGTGTTGTAAACCAGATGCTCC
4_T6SS_SPI-6_FOR AGACGCTGGCGAACACGATC
4_T6SS_SPI-6_REV TAAGCACTGGCCGTAGCTCTGG
5_T6SS_SPI-6_FOR GCAGCCATCCTTTGCACAAG
5_T6SS_SPI-6_REV GGTTGTGTTATTGGCGGCTTC
6_T6SS_SPI-6_FOR TATGCGATCAGGCGAACCTG
6_T6SS_SPI-6_REV TCTTCCTGTAACCGGGTATCCAG
7_T6SS_SPI-6_FOR GGTTGGATCAGGGACTGGATACC
7_T6SS_SPI-6_REV CGTAACCCTCAACATCCTGCG
8_T6SS_SPI-6_FOR AAAGCACCGGTGAATGTGGCTG
8_T6SS_SPI-6_REV TCGGTGTGGTCATCCTTACGGG
9_T6SS_SPI-6_FOR TGTCAGCACCAACAGTCGCC
9_T6SS_SPI-6_REV CGCCCTTCGATAGAATCTGGC
10_T6SS_SPI-6_FOR TAGTAGGGCCAGATTCTATCGAAGG
10_T6SS_SPI-6_REV CCCTCCGGCTTTTACACATTATTC
  1. aItalics indicate the region that anneals to the 5′ or 3′ end of the antibiotic resistance cassette used for the mutagenesis. Underline indicates Xba I restriction sites used for cloning an internal region of homology to T6SSSPI-6 into R995 plasmid.