Skip to main content

Table 1 Real-time quantitative RT-PCR probes and primers for turkey cytokines and primers for APEC genes used in this study

From: Analysis of immune responses induced by avian pathogenic Escherichia coli infection in turkeys and their association with resistance to homologous re-challenge

Target Primer/Probe Sequence (5′- 3′) Species Reference
Cytokines     
28S Probe (FAM)-AGGACCGCTACGGACCTCCACCA-(TAMRA) C, T [22]
  Forward GGCGAAGCCAGAGGAAACT   
  Reverse GACGACCGATTTGCACGTC   
IL-1β Probe (FAM)-CCACACTGCAGCTGGAGGAAGCC-(TAMRA) C, T [22]
  Forward GCTCTACATGTCGTGTGTGATGAG   
  Reverse TGTCGATGTCCCGCATGA   
CXCLi2 Probe (FAM)-TCTTTACCAGCGTCCTACCTTGCGACA-TAMRA C,T [23]
  Forward GCCCTCCTCCTGGTTTCAG   
  Reverse TGGCACCGCAGCTCATT   
IFN-γ Probe (FAM)-AAAGATATCATGGACCTGGCCAAGCTTCA-(TAMRA) T [23]
  Forward AACCTTCCTGATGGCGTGAA   
  Reverse CTTGCGCTGGATTCTCAAGTC   
IL-13 Probe (FAM)-TGCCAGCTGAGCACCGACAACG-(TAMRA) T [23]
  Forward CCTGCACGGCCAGATGA   
  Reverse GGCAAGAAGTTCCGCAGGTA   
IL-10 Probe (FAM)-CCTGAAGATGACAATGAAGCGCTGTCA-(TAMRA) T [23]
  Forward CGACCTGGGCAACATGCT   
  Reverse CCTCTCGCAGGTGAAGAAGTG   
TGF-β4 Probe (FAM)-ACCCAAAGGTTATATGGCCAACTTCTGCAT-(TAMRA) C, T [23]
  Forward AGGATCTGCAGTGGAAGTGGAT   
  Reverse CCCCGGGTTGTGTTGGT   
APEC genes     
iss Forward ATCACATAGGATTCTGCCG - [24]
  Reverse CAGCGGAGTATAGATGCCA   
iuc D Forward ACAAAAAGTTCTATCGCTTCC - [25]
  Reverse CCTGATCCAGATGATGCTC   
cvi/cva C Forward TGGTAGAATGTGCCAGAGCAAG - [24]
  Reverse GAGCTGTTTGTAGCGAAGCC   
tsh Forward ACTATTCTCTGCAGGAAGTC - [24]
  Reverse CTTCCGATGTTCTGAACGT   
  1. C = chicken, T = turkey.