Skip to main content

Table 1 Oligonucleotides used as primers in RT-qPCR analysis of gene expression in chicken cells.

From: Diacylated lipopeptide from Mycoplasma synoviae mediates TLR15 induced innate immune responses

Gene symbol RefSeq mRNA number Forward primer Reverse primer
GAPDH NM_204305.1 ATCGTCAAGGCTGAGAACGGG ATCTGCCCATTTGATGTTGCT
TLR15 NM_001037835.1 AACCTGGTGCATTTGAGAACCTGC TTTCAGGTGAGGTGCAAGACCAGA
TLR1 NM_001007488.3 AGCTGTGTCAGCATGAGAGGAACT AGTTGGGCGACAACACAAAGATGG
TLR2 NM_001161650.1 AGAACGACTCCAACTGGGTGGAAA AGAGCGTCTTGTGGCTCTTCTCAA
NM_204278.1
iNOS NM_204961.1 GCATTCTTATTGGCCCAGGA CATAGAGACGCTGCTGCCAG
NF-κB NM_205134.1 AGGACTTAAAATGGCAGGAGA GCTGTTCGTAGTGGTAAGTCT