Skip to main content

Table 1 Primers for chemokines, chemokine receptors, CD62L and reference gene used in quantitative real-time PCR.

From: Distribution of porcine monocytes in different lymphoid tissues and the lungs during experimental Actinobacillus pleuropneumoniae infection and the role of chemokines

Gene Alternative name Primer forward / reverse Tm Length of product
CCL1 I-309 CCGTGGTTCTGGTGTGCCTGCTG / ACATGCATGCTCTTGCTGTCCACCT 68.19/67.01 70
CCL2 MCP-1 CCGAAGCTTGAATCCTCATC / TAGCAGCAGGTGACTGGAGA 56.30/60.25 134
CCL3-like1 MIP-1αS TTTTGAGACCAGCAGCCAGT / TCAGCTCCAGGTCAGAGATG 59.82/58.52 122
CCL4 MIP-1β GCTCCCAGCCAGCCGTGGTATTC / CAGTCATCACTGGGGTTGGCGCA 67.64/67.50 70
CCL5 RANTES ACCACACCCTGCTGTTTTTC / GGCGGTTCTTTCTGGTGATA 58.89/57.60 124
CCL8 MCP-2 CAGTGTCCCCAGGAGGCTGTGATCTTC / GTCCGCGCAGACCTCCTTGTCG 68.18/67.74 60
CCL11 Eotaxin TCCCCAGAATGCTGTGATCTTCAGCAC / GGTCCAGGTACTCCATGGCATTCTGAACC 66.79/68.35 98
CCL17 TARC CTCCTCCTGGGGGCTTCCCTGC / CAGCACTCCCGGCCCACGTTG 68.64/68.37 68
CCL19 ELC CCACGCTGAAAGGTCGCGAGCTC / TTGCGGTGGTGCTTGCTCTTAGC 68.18/66.13 106
CCL20 MIP-3α TGCAGCAAGTCAGAAGCAGCAAGC / CGAGCTGCTGTGTGAAGCCCATG 66.60/66.44 100
CCL21 SLC CCCCCACACCCAAGGCAGTGATG / AACCCAGGCTTGGCTCCTGCTTC 67.60/67.31 116
CCL22 MDC TCAGACTCCTGCCGGAGGCCTG / CAGGGCAGTCTGGGGTCAGCAC 67.96/67.30 80
CCL25 TECK TTCTTCCAAGGCCCTCAGTCTGGAGTGA / ACTGTGGGCTCATGGTCCTGGAATAGC 68.56/68.05 147
CCL27 CTACK CCAGGCCTTCGTGCTTCACCTGTC / TCCCCTGGAGCCTCCTTCCATGG 67.69/67.54 104
CCL28 MEC GAAGCTATACTTCCCATTGCCTCCAGCT / TGCGCTTGACATGAAGGATGACAGCA 66.27/67.17 148
CXCL9 Mig AGCAGTGTTGCCTTGCTTTTGGGTATCATC / GCTGGTGTTGATGCAGGAACAACGTCC 67.76/68.40 102
CXCL10 IP-10 CCCACATGTTGAGATCATTGC / CATCCTTATCAGTAGTGCCG 57.57/55.44 168
CXCL11 I-TAC ACAAAACAGAAGTGATTGTCACCCTGAAAGCAC / GCTTGCTTTGATTTGGGATTTAGGCATCTTCGT 67.68/67.90 73
CXCL12 SDF-1α/β CCTCGTGCTGACCGCGCTCTG / CGAGAGAGTGGGACTGGGTTTGTTTAAAGCT 68.06/68.07 256
CXCL14 BRAK CGGCCAGCATGAGGCTCCTGAC / ACTTGCATTTGGACCCGTCCACGC 67.66/68.16 87
CXCL16 SR-PSOX TCGCGGAGAATGTGGACGTGCTC / TCGTCTGGGCAGGGGTGCTACTG 67.20/68.13 128
CX3CL1 Fractalkine-like GGCTGCTGGCCTTCCTTGGTCTC / GGGAGCAGCCCTGCAGACTCTGG 67.59/68.97 78
CCR1   GCTCCAGAAACAAAGACTTCGTGGACACAG / ATGTTGCTGCTAAAGGCAGTGGGCT 67.58/67.26 70
CCR2   TGCCACTTGGAAGAAGCAACAGACCG / CAGAGAGTGAGATGTGGGCAGCACG 67.54/67.21 100
CCR3   TCCCCATCAACGGGAGAGCAGGA / CTTCAGAGCTTCAGTGCTGTGCTGG 67.16/65.93 137
CCR4   GCCATTGTGCACGCGGTCTTCTC / GTGAAGCGAACACAGCCACCGAC 66.91/66.55 97
CCR5   TGGTCAGAGGAGCTGAGACA / AGAAGGGACTCGTCGTTTGA 59.89/58.67 86
CCR6   AGCGAGAGGGCGCTGGGCTAC / GTTGAGGCAGCAGTGCAGGAACG 68.88/66.60 69
CCR7   GTGGTGGCTCTCCTTGTCAT / GAAGCACACGGACTCGTACA 59.67/60.04 114
CCR9   CCACAGAAGCCGCAAGTCTGATGC / TGGCTTGCAAACTGCCTGACATGGT 66.45/67.64 139
CCR10   CTGCAGCTGCCCTACAGTCTCGC / AGATCCTTGCGCTTGCTGGCAGG 67.54/67.85 95
CXCR3   GTAGGGTGGACGTAGCCAAG / GGAACTTGACACCCACGAAG 59.82/58.77 96
CXCR4   TACCATGGACGGGTTCCGTATATTCACTTCAG / GCATTTTCCTCCCGGAAACAGGGTTCC 67.26/67.89 108
CXCR6   CCACTGACAGAGCACCTCTACTGGGTC / CCCCTGGCTGCTGTCGTTGGAAG 67.67/67.77 106
CX3CR1   CCAGTCACCTGCTGGCAACCCTACC / GGAAGCTGGTTTTGGGCTCTGGCTC 68.98/67.96 88
CD62L   AGCTTCTTGTCAGCCCAGGTCATGC / CCCAGAGGCTCACACTGAGTCACGAAC 67.25/68.46 132
CD163   CTTGGGGCAGCGTTGGCAGGAATAG / ATGCAGGGCTGATGTCCCCTCTGTC 68.02/68.16 99
SLA-DR   TGCTTGGAGTGTCACCATCTG / GGTCTGCTCTTTGTTGCTGTG 60.27/60.00 115
TBP1   AACAGTTCAGTAGTTATGAGCCAGA / AGATGTTCTCAAACGCTTCG 59.75/56.48 153
HPRT   GAGCTACTGTAATGACCAGTCAACG / CCAGTGTCAATTATATCTTCAACAATCAA 61.41/58.88 111