Skip to main content

Advertisement

Table 1 Sequences of the forward en reverse primers used to detect the DNA transcripts of the mRNA of goat’s TNF-α, IL-1β, IFN-α, IFN-γ, IL-2 and IL-10

From: Q fever in pregnant goats: humoral and cellular immune responses

Gene of interest NCBI code Primer Sequence
TNF-α X14828 Forward CCTTGAGAAGATCTCACCTA
   Reverse CAAACATAAACAGAGGGAGT
IL-1β DQ837160 Forward TACCTGTCTTGTGTGAAAAA
   Reverse CAAATTCAACTGTGTTCTTG
IFN-α FJ959074 Forward GAGGAAATACTTCCACAGAG
   Reverse ATGACTTCTGCTCTGACAAC
IFN-γ EF375708 Forward GAAATTTTGAAGAATTGGAA
   Reverse AATGACCTGGTTATCTTTGA
IL-2 AF535145 Forward GATGTCTAGAAGCAAGGGTA
   Reverse ACATCCAAATGAGTTCTGTT
IL-10 DQ837159 Forward GGCAAAGTGAAGACTTTCT
   Reverse ACTGGATCATTTCTGACAAG
  1. NCBI National Center for Biotechnology Information.