Skip to main content

Table 1 Oligonucleotide sequences.

From: Development of a self-replicating plasmid system for Mycoplasma hyopneumoniae

PCR product Size (bp) Restriction site Oligonucleotide sequence (5′ - 3′)
M. hyopneumoniae strain 232 oriC- i 2130 Nco I F - AGGCCATGG TTGTTAATTATTGCTTGAAATTC
   Spe I R - AGTACTAGT AAACTTTATAGGAAAGTTCG
M. hyopneumoniae strain 232 oriC- ii 1823 Nco I F - GATGCCATGG TTGGTTGATAAGTTCGCTTC
   Spe I R - GTAGACTAGT CATTCTTTCAATTTGTCATTC
M. hyopneumoniae strain 232 oriC- iii 859 Nco I F - GATGCCATGG TTGGTTGATAAGTTCGCTTC
   Spe I R - GCTCACTAGT GACAATCAGTTTAAAAATTCAC
M. hyopneumoniae strain 232 oriC- iii 859 Aat II F - GCAGGACGTC TTGGTTGATAAGTTCGCTCC
   Nco I R - GACGCCATGG GACAATCAGTTTAAAAATTCAC
M. hyopneumoniae strain 232 oriC- iv 422 Nco I F - GCATCCATGG ATATTGTGCATGCCCGCGGATAT
   Spe I R - GTAGACTAGT CATTCTTTCAATTTGTCATTC
M. hyopneumoniae strain 232 oriC- v 280 Aat II F - GCAGGACGTC TTGGTTGATAAGTTCGCTCC
   Nco I R - CGTACCATGG CCTAATTTGCTGTGTTCTAA
tetM + spiralin promoter from plasmid pSRT2 2320 Pst I F - TAACTGCAG CAAAAGCTTGCATGCCTGCA
   Spe I R - GTCACTAGT CAGTTCAGATCTTTATATAAC
tetM from plasmid pIVT 2109 Spe I F - ATCTACTAGT CATGTGATTCTAAAGTATCC
   Pst I R - GATCTGCAG CTTATTTAACAAGAAACC
tetM (without promoter) from plasmid pSRT2 1963 Bam HI/Pst I F - GAACTGCAGGATCC ATGGAGGAAAATCACATGA
   Sal I R - CCCGGTCGACTTATATAACAACTTAAATTAC
M. hyopneumoniae strain 232 P97 promoter 619 Bam HI F - GAATGGATCCCCAACAATTCCGGCAGTC
   Spe I R - GCTAACTAGT ACGGGGATTTAAAACAGAAAC
M. hyopneumoniae strain 232 ldh promoter 421 Spe I F - GGCTAACTAGT ATAGAATTTTGCAATTAAAG
   Bam HI R - CTTAGGATCC ATTTATACTCGTATTTGTTAT
M. hyorhinis oriC 1479 Nco I F - GACTCCATGG TCGGAATCGAGATTCCTAATT
   Spe I R - GCCTACTAGT CTACACCTTCGATTTCTCTAA
M. pulmonis oriC 1909 Nco I F - ATTAGCCATGG CACTCTGGTCAGCGCTAGATC
   Nhe I R - TCGCGCTAGC CTAACTTGAAAATAAGCTCC
M. conjunctivae oriC 2307 Nco I F - GATACCATGG TATGCCTTTGGTCTAGGATG
   Xba I R - CGATGTCTAGA CCCTTGAACAAATATACCA
M. ovipneumoniae oriC 2102 Nco I F – AGTCCATGGTCAATTATTGCTTGGAATTC
   Spe I R - CGTACTAGTAAACTTTATAAGAAAGTTCGCT
bla gene (DIG-labelled probe) 860 N/A F – CCAATGCTTAATCAGTGAGG
    R - GTATGAGTATTCAACATTTCCG
tetM (DIG-labelled probe) 406 N/A F – GTGGACAAAGGTACAACGAG
    R - CGGTAAAGTTCGTCACACAC
  1. Oligonucleotide sequences are shown along with the size of the PCR product generated and the template DNA used. Restriction enzyme sites (where applicable) that were added to the 5′ end of the oligonucleotide are shown in italics. Forward (F) and reverse (R) oligonucleotides are shown.