Skip to main content

Table 1 Oligonucleotides used in this study

From: Contingency nature of Helicobacter bizzozeronii oxygen-insensitive NAD(P)H-nitroreductase (HBZC1_00960) and its role in metronidazole resistance

Oligonucleotides Sequence
HBrdxAupFW-PstI ATTCTGCAGTGCAACACCCCAAACCCCTACACCATG
HBrdxAupRw-XbaI CATCTAGACCACGCAGATAATCCGCATTGAGAGAACC
HBrdxAdwFW-KpnI ATAGGTACCGGTTCTCTCAATGCGGATTATCTGCGTGG
HBrdxAdwRW-EcoRI ATGAATTCTACTTGCTCAAAGCCACTTGATCGC
RdxAoutFw TTCAAACGCGCCCAAGAGAGC
RdxAoutRw GCGACCAACGCCAAGCCCAAGAC