Skip to main content

Table 1 Primers and probes.

From: The IL-10 homologue encoded by cyprinid herpesvirus 3 is essential neither for viral replication in vitro nor for virulence in vivo

Targeted gene Primer/probe name   Sequence (5’- 3’) Accession n°/ reference
Primers for PCR and RT-PCR PCR RT-PCR   
Carp β-actin Actin-F   ATGTACGTTGCCATCCAGGC M24113
Primers for amplification of recombination cassettes
H1-gal K-H2 cassette 134 gal K F    ATGTTCCTTGCAGTGCTACTAACCG Warming et al. [34]
Primers and probes for real-time TaqMan PCR quantification of CyHV-3 genome
Carp glucokinase CgGluc-162F    ACTGCGAGTGGAGACACATGAT AF053332
Primers for RT-qPCR analysis of carp gene expression
TNF-α1 and 2 TNF-α1 and 2-F    GCTGTCTGCTTCACGCTCAA AJ311800
  1. Underlined: 50bp corresponding to CyHV-3 sequence.