Skip to main content

Advertisement

Table 1 Primers and probes.

From: The IL-10 homologue encoded by cyprinid herpesvirus 3 is essential neither for viral replication in vitro nor for virulence in vivo

Targeted gene Primer/probe name   Sequence (5’- 3’) Accession n°/ reference
Primers for PCR and RT-PCR PCR RT-PCR   
CyHV-3 ORF3 ORF3InF   TATGCCCACATGATGCTGTT DQ657948
  ORF3InR   CAGTCAGACCCTTCCTCTGC  
CyHV-3 ORF55 ORF55InF   AGCGCTACACCGAAGAGTCC  
  ORF55stopR   TCACAGGATAGATATGTTACAAG  
  ORF55ATGF   ATGGCTATGCTGGAACTGG  
  ORF55InR   GGCGCACCCAGTAGATTATG  
CyHV-3 ORF78 ORF78InF   TGGACGACGAACACCCTTC  
  ORF78InR   GGTAGAGGGTACAACCACG  
CyHV-3 ORF132 ORF132InF   GGATCCGTTTTCTGGGTCTG  
  ORF132InR   CTCAATCCCTCACCGACCTC  
CyHV-3 ORF133 ORF133InF   GACGAGATCCCTATCCGCAG  
  ORF133InR   GACCTCGGGTATGGTCGGTA  
CyHV-3 ORF134 ORF134stopF   TCAATGTTTGCGCTTGGTTTTC  
  ORF134ATGR   ATGTTCCTTGCAGTGCTAC  
  ORF134InF   GGTTTCTCTTTGTAGTTTTCCG  
  ORF134InR   CACCCCAACTTTTGAGACAAC  
  ORF134outseqF   GTCAACATGGACGAGCGTGA  
  ORF134outseqR   GTGGGGATATCAAACACGCA  
CyHV-3 ORF135 ORF135InF   ACACCACCAACGAGACATGC  
  ORF135InR   CTTTTCGGACCAGAAGACCG  
Carp β-actin Actin-F   ATGTACGTTGCCATCCAGGC M24113
  Actin-R   GCACCTGAACCTCTCATTGC  
Primers for amplification of recombination cassettes
H1-gal K-H2 cassette 134 gal K F    ATGTTCCTTGCAGTGCTACTAACCG Warming et al. [34]
CGACCATCTTCTTCGAGGCTCGGGG
CCTGTTGACAATTAATCATCGGCA
  134 gal K R    TCAATGTTTGCGCTTGGTTTTCATG  
TTCTTGACGTCTTTTGCGACCAGGA
TCAGCACTGTCCTGCTCCTT
H1-ORF134-H2 H1F    GCTCATCAATCGCAGCAGCA DQ657948
cassette
  H2R    CAAGCCATTATCCTGTTGGG  
Primers and probes for real-time TaqMan PCR quantification of CyHV-3 genome
CyHV-3 ORF89 KHV-86F    GACGCCGGAGACCTTGTG AF411803
  KHV-163R    CGGGTTCTTATTTTTGTCCTTGTT  
  KHV-109P    (6FAM)CTTCCTCTGCTCGGCGAGCACG(BHQ1)  
Carp glucokinase CgGluc-162F    ACTGCGAGTGGAGACACATGAT AF053332
  CgGluc-230R    TCAGGTGTGGAGCGGACAT  
  CgGluc-185P    (6FAM)AAGCCAGTGTCAAAATGCTGCCCACT(BHQ1)  
Primers for RT-qPCR analysis of carp gene expression
40S 40S-F    CCGTGGGTGACATCGTTACA AB012087
  40S-R    TCAGGACATTGAACCTCACTGTCT  
IL-1β IL-1β-F    AAGGAGGCCAGTGGCTCTGT AJ245635
  IL-1β-R    CCTGAAGAAGAGGAGGCTGTCA  
TNF-α1 and 2 TNF-α1 and 2-F    GCTGTCTGCTTCACGCTCAA AJ311800
  TNF-α1 and 2-R    CCTTGGAAGTGACATTTGCTTTT  
CXCa CXCa-F    CTGGGATTCCTGACCATTGGT AJ421443
  CXCa-R    GTTGGCTCTCTGTTTCAATGCA  
IL-10 IL-10-F    CGCCAGCATAAAGAACTCGT AB110780
  IL-10-R    TGCCAAATACTGCTCGATGT  
IFNγ-2 IFNγ-2-F    TCTTGAGGAACCTGAGCAGAA AM168523
  IFNγ-2-R    TGTGCAAGTCTTTCCTTTGTAG  
IL-6 IL-6M17-F    CACATTGCTGTGAGGGTGAA AY102633
  IL-6M17-R    GCATCCATAGGCTTTCTGCT  
  1. Underlined: 50bp corresponding to CyHV-3 sequence.