Skip to main content

Table 2 Primers targeting the prophage-associated genomic island of porcine L. intracellularis isolates and the two flanking genes

From: Comparative genome sequencing identifies a prophage-associated genomic island linked to host adaptation of Lawsonia intracellularis infections

Gene Gene product Entrez gene ID Primers (5′ → 3′)
LI0172* Hypothetical protein 4059866 ATTGATGCTCCTGTCCCACG
  ACCACATGGTGGATTCGTCC
LI0173 Prophage DLP12 integrase 4059867 CGTCGTATTCTGCGCTTTGG
  ATCATCAGCTACACGAGCGG
LI0174 Hypothetical protein 4059868 CAGGAAGATGCTGTGTGGCT
  ATTCGCTTTCGCAATACGGC
LI0175 Hypothetical protein 4059869 CCCACGGACGAAGACTTTGA
  TCAGCTTTCGGGCATGGATT
LI0176 Hypothetical protein 4059870 ACAGACCTCTATGCTCCCGT
  TCAGCGTCTTGGGGCTTTAG
LI0177 Hypothetical protein 4059871 ACACCACCATTACCACTGCT
  ACACCACCATTACCACTGCT
LI0178 Hypothetical protein 4059872 TTCCTCCTGCGTGTCGTAAC
  ATTTCTCCCTGGCTCTGCAC
LI0179 Ribosomal protection tetracycline resistance protein 4059813 CGTCAGCAAAGCGGAAACAA
  AAACGGCCTTGGCATTCAAC
LI0180 Hypothetical protein 4059873 GAACCGGTGAGCCAAGTGTA
  TTCCTTCGGGAGTCGAGGAT
LI0181 Endonuclease I 4059874 AGGCTAAGCGCATACTGCAA
  CAGCATTGACAGACCCGACT
LI0182 Recombination protein-phage associated 4059875 TGGATTTCCAGCACAGCCAT
  TGAACCGTCCTGAAGCTCAC
LI0183 Hypothetical protein 4060170 CTCTCGACGCATCTTCCCTC
  TCCATTCCGCCGTCATGAAA
LI0184 Hypothetical protein 4060171 TTGGACTGGCTCTTACGCAG
  GATGAAGCCCACGTCAGGAA
LI0185 MoxR-like ATPases 4060172 GTCATGCGTCAGAACATCGC
  CCTGTTTGGAGAGAGGCTGG
LI0186 Hypothetical protein 4060173 CCTTCCTGGGCCAACATCAT
  CACGCTTGGGCATATTTCCG
LI0187 Hypothetical protein 4060174 ATCGGTTCTTCGGATACCGC
  GAATCCTGCGTAGATCGGCA
LI0188* ATP-dependent Zn proteases (ftsH) 4059755 GAGCTGTAGCTGGTGAAGCA
    ACGTGCAACAAGTGCATGTC
  1. * Flanking genes located before and after the prophage-associated genomic island.