Skip to main content

Table 2 Gene-specific oligonucleotide primers used for qPCR

From: Differential response of bovine mammary epithelial cells to Staphylococcus aureus or Escherichia coli agonists of the innate immune system

Gene symbol Oligonucleotides (5′-3′) Amplicon Annealing Accession
F: forward ; R: reverse (bp) Temperature (°C) number (GenBank)
18 s rRNA F: CGGGGAGGTAGTGACGAAA 196 69 AF176811
  R: CCGCTCCCAAGATCCAACTA    
TNFa F:TCTTCTCAAGCCTCAAGTAACAAGC 104 69 EU276079
  R: CCATGAGGGCATTGGCATAC    
Il6 F: TGCTGGTCTTCTGGAGTATC 153 62 EU276071
  R: GTGGCTGGAGTGGTTATTAG    
Ccl2 F: GCTCGCTCAGCCAGATGCAA 117 62 NM174006
  R: GGACACTTGCTGCTGGTGACTC    
Ccl5 F: CTGCCTTCGCTGTCCTCCTGATG 217 62 NM175827
  R: TTCTCTGGGTTGGCGCACACCTG    
Ccl20 F: TTCGACTGCTGTCTCCGATA 172 62 NM174263
  R: GCACAACTTGTTTCACCCACT    
CD83 F: GAA GGG CAG AGA AAC CTG AC 231 65°C BC112861
  R : AGA GGT GAC TGG GAG GAA AG    
Nos2 F: CTT GAG CGA GTG GTG GAT GG 240 64 NM001076799
  R: CCT TCA TCC TGG ACG TGG TTC    
Isg15 F: CGC-CCA-GAA-GAT-CAA-TGT-GC    NM_174366
  R: TCC-TCA-CCA-GGA-TGG-AGA-TG 158 62  
Cxcl10 F: TTC-AGG-CAG-TCT-GAG-CCT-AC 218 62 NM_001046551
  R: ACG-TGG-GCA-GGA-TTG-ACT-TG