Skip to main content

Table 1 Primers used in this study

From: Both flagella and F4 fimbriae from F4ac+ enterotoxigenic Escherichia coli contribute to attachment to IPEC-J2 cells in vitro

Primer Sequences (5′-3′)
ΔfliC-Cm-F TATCGAGCGTCTGTCTTCTGGCTTGCGTATTAACAGCGCGAAGGATGACGTGTGTAGGCTGGAGCTGCTTCG
ΔfliC-Cm-R ACGGGACTGCGCTTCRGACAGGTTGGTAGTGGTGTTGTTCAGGTTGGTCATATGAATATCCTCCTTAG
ΔfaeG-Cm-F ATTTCAATGGTTCGGTCGATATCGGTGGTAGTATCACTGCAGATGATTATTGTGTAGGCTGGAGCTGCTTCG
ΔfaeG-Cm-R AGTTACAGCCTGATTAAAAGTTGCCTCAATAGTCTGACCGTTTGCAATCATATGAATATCCTCCTTAG
ΔmotA-Cm-F TCGGTACAGTTTTCGGCGGTTATTTGATGACCGGTGGAAGCCTTGGAGCATGTGTAGGCTGGAGCTGCTTCG
ΔmotA-Cm-R CGACGGACGTTCGCTGGAATAGAGCGTTTTGCGACCAAACTCAACGGCCATATGAATATCCTCCTTAG
fliC-F ATGGCACAAGTCATTAATACCAACA
fliC-R TTAACCCTGCAGCAGAGACAGA
faeG-F ATGAAAAAGACTCTGATTGCACTG
faeG-R TTAGTAATAAGTAATTGCTACGTTC
motA-F GTGCTTATCTTATTAGGTTACCTGGTTGT
motA-R TCATGCTTCCTCGGTTGTCGT
pBR-fliC-F GCTCTAGAATGGCACAAGTCATTAATACCAACAG
pBR-fliC-R CAGCGTCGACTTAACCCTGCAGCAGAGACAGAAC
gapA-RT-F CGTTAAAGGCGCTAACTTCG
gapA-RT-R ACGGTGGTCATCAGACCTTC
faeG-RT-F ACTCAGAAAACCTGATGGTGAAACT
faeG-RT-R CCCCACCTCTCCCTAACACA
fliC-RT-F TCGACAAATTCCGCTCCTC
fliC-RT-R GGTTGGTGGTGGTGTTGTTC