Skip to main content

Table 1 Sequences and abundance of top ten predicted conserved miRNA families of heartworms

From: Identification of Dirofilaria immitis miRNA using illumina deep sequencing

Name Sequencea Count
miR-1 TGGAATGTAAAGAAGTATGT 718580
miR-71 TGAAAGACATGGGTAGTGAGACG 289744
miR-228 AATGGCACTAGATGAATTCACGG 241479
miR-100 TACCCGTAGCTCCGAATATGTGT 230351
let-7 TGAGGTAGTAGGTTGTATAGTT 229047
miR-279 TGACTAGAACCATACTCAGCT 114228
miR-9 TCTTTGGTTATCTAGCTGTATGA 106805
miR-101 TACATACTGGAGGAGCTGAA 99626
miR-2 TATCACAGGCCTGATGCAGCGAG 78387
miR-769 TGAGATTCTGGGTTTGAAC 77756
  1. a denotes the miRNA sequence with the highest count of the entire miRNA family.