Skip to main content

Table 1 Primer pairs used for quantification of gene expression by qPCR

From: CD27 expression discriminates porcine T helper cells with functionally distinct properties

Target Accession number Primer sequence Forward (F), Reverse (R) Position on + strand Product length (bp) Source
CD62L NM_001112678.1 F: AGCAAAGACTCCGGGAAGTG 404 247 designed by primer3[17]
R: AGAACTTGCCCAAAGGGTGA 651
CX3CR1 XM_003358374.1 F: CGCAGGACAGGGTGGCGGAT −67 217 designed by primer BLAST[18]
   R: ATTGCCCACGAGGCCAAAGGC 150   
  1. Sequences of primers (5’-3’), primer positions on (+) strand relative to the ATG start codon and product length in base pairs (bp) are indicated.