Skip to main content

Table 1 Primers used for measurement of equine TF mRNA by quantitative real-time PCR

From: Equine herpesvirus type 1 infection induces procoagulant activity in equine monocytes

Gene Length (bp) Amplicon size Sequence (5’ – 3’)
Equus caballus TF forward 23 243 5' - GTGGCTAGAGCCGCAGGGACTAG
Equus caballus TF reverse 21 243 5' - AGGAAGAGACCCGCGCCATGT
Equus caballus β2-microglobulin forward 22 209 5’ - TGTCTCTGGGTTCCATCCGCCT
Equus caballus β2-microglobulin reverse 25 209 5’ - CGGACCCACTTAACTATCAGGGGGT