Skip to main content

Table 1 Primer sequences for real-time PCR in mouse mammary glands.

From: Underlying mechanisms involved in the decrease of milk secretion during Escherichia coli endotoxin induced mastitis in lactating mice

Gene Accession number Primers   Product size
   Forward Reverse  
SLC1A4 NM_018861 cgcaggacagattttcacca catccccttccacattcacc 197
SLC7A1 NM_007513 cgtccctcctcatttgcttc gcgattacgggtgttttggt 289
SLC27A3 NM_011988 tctgggacgattgccagaaac caagcgcaccttatggtcacac 116
AQP3 NM_016689 ctggacgctttcactgtgggc gatctgctccttgtgtttcatg 309
GLUT-1 NM_011400 gcttcctgctcatcaatcgt gccgaccctcttctttcatc 117
UGP2 NM_139297 tcacaaacaaaacacgagcaga cacttgagcgatttccacca 89
PGM2 NM_028132 caagcaagctgtccctctgt gatgtcctccacgctctgtt 137
α-lactalbumin NM_010679 accagtggctacgacacac cggggaactcactacttttacac 106
FABP3 NM_010174 agtcactggtgacgctggacg aggcagcatggtgctgagctg 230
SREBP-1 NM_011480 gtcagcttgtggcagtggag tctgagggtggaggggtaag 90
CSN1S1 NM_007784 cctttcccctttgggcttac tgaggtggatggagaatgga 193
CSN2 NM_009972 cttcagaaggtgaatctcatggg cagattagcaagactggcaagg 330
CSN3 NM_007786 tcgaccccattactcccattgtgt tgtaaaaggtaagggaagacgagaaagat 289
WAP NM_011709 aacattggtgttccgaaagc agggttatcactggcactgg 179
Lactoferrin NM_008522 ggctgagaaggcaggaaatg tttggggctatggctaggtg 183
VAMP-3 NM_009498 gctgccactggcagtaatcgaagac gagagcttctggtctctttc 113
VAMP-4 NM_016796 gggaccatctggaccaagatttgg catccacgccaccacatttgcctt 225
Syntaxin-6 NM_021433 cgactggacaacgtgatgaa ctgggcgaggaatgtaagtg 216
SNAP-23 NM_001177792 gtgttgtggcctctgcatct ccatctcatcttctctggcatc 254
Adipophilin NM_007408 caggggtggtggataagacc ggtgataagcccgagagca 291
GAPDH NM_008084 gagcgagaccccactaacatc gcggagatgatgaccctttt 144