Skip to main content

Table 2 List of oligonucleotides used.

From: Deletion of the GI-2 integrase and the wbkA flanking transposase improves the stability of Brucella melitensis Rev 1 vaccine

Name Sequence (5′→ 3′) Name in Figure1 Reference
711u cacaagactgcgttgccgacaga   [23]
711d catatgatgggaccaaacacctaggg   [23]
BMEI0999F cacgatcaaaacgatgccct   This study
BMEI0999R ccaaaatgtcctgagcttgg   This study
BMEI1404F aagggctggaacctaggaga   This study
BMEI1404R aatgacttccgctgccatag   This study
BMEI0993F caacatcgcaaagcctgaaa P1 [10]
BMEI1013R cgcaatccagccaatacctg P2 [10]
BMEI0994R atcgtcggcattgtctctct P3 [10]
BMEI1012bF attatccggcggtatgtgag P4 [10]
BMEI1398F gatcttggtatcggcctgtc P5 [14]
BMEI1413R tgcgactttcttcacgattg P6 [14]
BMEI1400R cgctttaatatctcgcgttcc P7 [14]
BMEI1409F ggtcccatcggcatatctt P8 [14]
BMEI1426F ctggagtgtgccgaaagtg P9 This study
BMEI1427R gctgatctcttccgacaagg P10 This study
BMEI0998F ttaagcgctgatgccatttccttcac P11 This study
BMEI0998R gccaaccaacccaaatgctcacaa P12 This study
BMEII0898F tcggcacagcaagctataaa P13 This study
BMEII0912R ggtgtggatattgcgctttc P14 This study
BMEII0899F ccgcctatgcctatacgatg P15 This study
BMEII0899R gcctcatcatccttgtcgat P16 This study
BMEI1401_F1 ttctcgagagcctgaagagc   This study
BMEI1401_R2 gccttcgtcgagaaaatgag   This study
BMEI1397_F3 ctcattttctcgacgaaggccgtttgcatcaatcagttcg   This study
BMEI1397_R4 ctcggctggcagtatctttc   This study
BMEI1012_F1 caaagagctaagggcattcg   This study
BMEI1012_R2 cgcgaaactttgaagcatct   This study
BMEI1012_F3 agatgcttcaaagtttcgcgtctatatcgccggtctgtcc   This study
BMEI1012_R4 tttcagtgctttatgacgaaaat   This study
  1. F, forward; R, reverse.