Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Sequences of primers used for RT-qPCR and uncorrected ( p ) sequence distance of obtained pigeon amplicons to chicken mRNA

From: Modulation of the host Th1 immune response in pigeon protozoal encephalitis caused by Sarcocystis calchasi

RNA target 5-3 primer sequences Amplicon size (bp) Primer efficiency (%) p-distance* Accession number**
beta-actin F: AAGGACCTGTACGCCAACAC 211 91.8 0.024 NM_205518
GUSB F: GGGGCAAACTCCTTCCG 223 92.2 0.127 NM_001039316
HMBS F: CTGGCCCGGATTCAGAC 154 96.3 0.166 XM_417846
RPL13 F: CCACAAGGACTGGCAGCG 135 92.0 0.095 NM_204999
IL-1 F: CGAGAGCAGCTACGCCG 271 99.6 0.176 DQ393270
IL-6 F: CTGCCCAAGGTGACGGAG 178 97.9 0.3 HM179640
IL-7 F: CAGAGTATCGTGACAGATGCTGC 174 101.3 0.111 NM_001037833
IL-12 F: AGTGAAGGAGTTCCCAGATGC 188 90.0 0.194 DQ202328
IL-15 F: GAATGCCAGGAACCTGTAATG 246 102.5 0.142 HQ005358
IL-18 F: GCCAGTTGCTTGTGGTTCG 160 100.8 0.141 AY775782
IFN-γ F: CAGATGTAGCTGACGGTGGAC 276 93.2 0.178 DQ479967
TGF-β2 F: GAAGAAGCGTGCTCTAGATGC 105 100.1 0.019 ENSGALT00000015664
TL1A F: CCTGAGTTATTCCAGCAACGCA 285 95.3 0.111 NM_001024578
  1. *compared to chicken by MEGA5 software. **of chicken.