Skip to main content

Advertisement

Table 2 A list of oligonucleotides used as primers in RT-qPCR analysis of gene expression in chicken chondrocytes.

From: Mycoplasma synoviae induces upregulation of apoptotic genes, secretion of nitric oxide and appearance of an apoptotic phenotype in infected chicken chondrocytes

Gene symbol RefSeq mRNA number Forward primers Reverse primers Amplicon lenght Reference Encoded protein function
Casp3 NM_204725.1 TGGCCCTCTTGAACTGAAAG TCCACTGTCTGCTTCAATACC 139 IDT1 Caspase 3: apoptosis related cysteine peptidase from the group of effector caspases.
Bak1 NM_001030920.1 GCCCTGCTGGGTTTCGGTAA AATTCGGTGACGTAGCGGGC 95 NCBI2 Bcl2 antagonist/killer: pro-apoptotic member of the Bcl2 family, involved in mitochondrial pore formation.
Fas XM_421659.2 CCTGCTCCTCATCATTGTGT TGATCCATGTACTCCTCTCC 258 [20] Fas: TNF receptor superfamily, member 6.
FASLG NM_001031559.1 GGAGAAGGAACTGGCTGAAC GGTTTCCTGTTAAGTGTGCTG 134 IDT1 Fas ligand: TNF superfamily, member 6.
tp53 NM_205264.1 ACCTGCACTTACTCCCCGGT TCTTATAGACGGCCACGGCG 127 NCBI2 Tumor protein p53: tumor suppressor, activator of apoptosis through induction of BAX expression.
AIFM1 NM_001007490.1 GAAGTACAACAACGGCTGAC GAGACAGAGACAGACTTGAC 299 IDT1 Apoptosis-inducing factor: pro-apoptotic mitochondrial protein, responsible for caspase-independent DNA cleavage.
CASP8 NM_204592.2 GGACAGGACTGAGCTGGCGT AGGTCCCCCACCTCGATCATC 135 NCBI2 Caspase 8: apoptosis related cysteine peptidase from the group of initiator caspases.
BCL2 NM_205339 GATGACCGAGTACCTGAACC CAGGAGAAATCGAACAAAGGC 114 IDT1 B-cell CLL/lymphoma 2: anti-apoptotic member of the Bcl2 family, blocks mitochondrial pore formation.
endog XM_415487.2 GAACAACGTGGCCGTCCCT GGGCATCACATAGGAGCGCA 91 NCBI2 Endonuclease G: mitochondrial endonuclease, released from mitochondria during apoptosis.
XIAP NM_204588.1 GCAGAATATGAGAGGCGGATAC TCCTTCCACTCTTGCAATCC 149 IDT1 X-linked inhibitor of apoptosis: a nti-apoptotic protein from the IAP family, blocks caspase 3 activation by inhibiting caspase 9.
NOS2 NM_204961.1 GCATTCTTATTGGCCCAGGA CATAGAGACGCTGCTGCCAG 66 IDT1 Nitric oxide synthase 2, inducible: pleiotropic immune system regulator, inducer of apoptosis in chondrocytes.
NFκB1 NM_205134.1 AGGACTTAAAATGGCAGGAGAG GCTGTTCGTAGTGGTAAGTCTG 141 IDT1 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1: transcription factor with pro- or anti-apoptotic functions.
CD44 NM_204860.2 AGCACTGGTCTTTACTGGAAC TCTGAGCAACTTGGGAAACTG 93 IDT1 CD44 molecule (Indian blood group): hyaluronan receptor, involved in interaction of the cell with the extracellular matrix, capable of inducing caspase-independent death via calpain-dependent AIF release. Crosslinking of CD44 augments Fas expression and mRNA transcription.
htrA3 XM_420813.2 CCTCCCGCGGCTTCGTATTC TGCAGTCGCGGTGCAGTAAG 116 NCBI2 HtrA serine peptidase 3: mitochondrial serine peptidase, inhibits XIAP.
Mapk11 (p38B) NM_001006227.1 GCGGCTCCGCTAAAATGCCG GGGGTGAGGTTCTGGTAGCGC 97 NCBI2 Mitogen-activated protein kinase 11: stimulates caspase 3 activity, NFκB expression and p53 expression and protein stability.
GAPDH NM_204305.1 ATGGCATCCAAGGAGTGAGC AACAAAGGGTCCTGCTTCCC 66 [39] Glyceraldehide-3-phosphate dehydrogenase: enzyme in carbohydrate metabolism.
  1. 1 Designed in Integrated DNA Technologies PrimerQuestSM application 2 Designed in NCBI Primer-BLAST application