Skip to main content

Table 1 Olignucleotide primers used in this study

From: The role of glycoprotein H of equine herpesviruses 1 and 4 (EHV-1 and EHV-4) in cellular host range and integrin binding

Primer Product Sequence
P1 EHV-1gH tat ggatcc atgttacaaccgtatcgaaaa
P2 ata gggccc ttactcataactcaataacaa
P3 EHV-4gH tat ggatcc atgtcacaaccgtatctaaaa
P4 ata gggccc ttactcagagtttaataacaa
P5 Kan-1 ggcgcggccgc cggttcgcatgttatcctcaaggatgacgacgataagtaggga,b
P6 ccggcggccgc gccaacagcaaaaaatagcacaaccaattaaccaattctgattaga,b
P7 Kan-4 tattctaga aagccgctaccaaacgcggtaggatgacgacgataagtaggga,b
P8 ctttctaga ataagcgtacacgcttttcacaaccaattaaccaattctgattaga,b
P9 gH1-deletion gtggctgtacattaacttgggaatcattacttccgcgatcacaaatatcccgtgtgttgtaggatgacgacgataagtagggb
P10 attgtctaacatggggggtaacaacacacgggatatttgtgatcgcggaagtaatgattccaaccaattaaccaattctgattagb
P11 gH4-deletion atccagtggttgtatattgggaataaatactgctgcgattacacaaacaatgtctagtgtaggatgacgacgataagtagggb
P12 ctgtttacacgcaatacaacacactagacattgtttgtgtaatcgcagcagtatttattccaaccaattaaccaattctgattagb
P13 gH4-Kan aagatataccgtggctgtacattaacttgggaatcattacttccgcgatcatgtcacaaccgtatctaaa
P14 tcgcacaaatattgtctaacatggggggtaacaacacacgggatatttgtttactcagagtttaataaca
P15 gH1-Kan tactcgaggtatccagtggttgtatattgggaataaatactgctgcgattatgttacaaccgtatcgaaa
P16 actcgtatactgtttacacgcaatacaacacactagacattgtttgtgtttactcataactcaataaca
P17 gH440A ccagtttgacgttgcacaatcccagattgagaaaatagtgG cagatatcaacgtggaggccaggatgacgacgataagtagggb,c
P18 tacatcggtttgcgcaattcggcctccacgttgatatctgC cactattttctcaatctgggcaaccaattaaccaattctgattagb,c
P19 Primers for sequencing tgtgacctggattcatttag
P20 aacaattttacgcgtaatat
P21 ttgtgctcttaaatcattta
P22 gccgcattcccgtttatagc
P23 taatgtcaaaaaatctttta
P24 gtttacgtactcagcgatgg
P25 ccatacgtgatataactgat
P26 gtgaggataacatgcgaacc
P27 atgacaatttggagccgttt
P28 tatgcaggacctatctacaa
P29 actataggctttgctatatt
  1. aRestriction enzyme sites are given in lower case bold letters; sequences in italics indicate additional bases which are not present in the EHV-1 or -4 sequence.
  2. bUnderlined sequences indicate the template binding region of the primers for PCR amplification with pEPkan-S.
  3. cUpper case bold letters indicate the nucleotides that were mutated.