Skip to main content

Advertisement

Table 3 Primers used for RT-PCR and nucleotide sequencing.

From: Improved strategy for phylogenetic analysis of classical swine fever virus based on full-length E2 encoding sequences

primer location1 used for sequence (5´- > 3´)
PCR sequencing
P100 99-121 PCR1 + CATGCCCTTAGTAGGACTAGCAC
CSF1400r 1401-1419 PCR1 + CACCAYCCRTGTTTRTTCC
CSF1300f 1280-1299 PCR2 + AAAATATGYAARGGRGTCC
CSF2400r 2396-2415 PCR2 + AGCCATAYYAYACCTTGCAC
CSF2250f 2224-2243 PCR3 + TGTTAGRCCRGRYTGGTGGC
CSF3710r 3708-3728 PCR3 + TRGTYTTRACTGGRTTGTTRG
CSF3000r 2988-3009 - + TTYACACATGTCCARTTRCCCC
CSF3010f 2990-3012 - + GGYAAYTGGACATGTGTRAAAGG
CSF2919f 2900-2919 - + ACCTTCAGGAGAGATAAGCC
  1. 1 Numbers refer to the sequence of CSFV strain Alfort187 [GenBank: X87939].