Skip to main content

Advertisement

Table 1 Primer sequences and annealing temperatures of primer sets (°C), expected PCR fragment sizes (bp) and associated references.

From: Effect of Saccharomyces cerevisiae var. Boulardii and β-galactomannan oligosaccharide on porcine intestinal epithelial and dendritic cells challenged in vitro with Escherichia coli F4 (K88)

Genes Sense Antisense T° Annealing Product length Accession
Number
Reference
APRIL TGCTCACCCGTAAACAGAAG TAAACTCCAGCATCCCAGAC 60 172 EST BP170456 [21]
BAFF GAGAGCAGCTCCATTCAAAG GCATGCCACTGTCTGCAATC 60 103 NM_001097498 [21]
CCL2 GTCACCAGCAGCAAGTGTC CCAGGTGGCTTATGGAGTC 60 112 EF107669 [43]
CCL17 TGCTGCTCCTGGTTGCTCTC ATGGCGTCCCTGGTACACTC 67 169 EST DB794536 [20]
CCL20 GCTCCTGGCTGCTTTGATGTC CATTGGCGAGCTGCTGTGTG 66 146 NM 001024589 [21]
CCR7 AGGAGGCTCAAGACCATGAC GATGCCGAAGATGAGTTTGC 62 147 AB090356  
CXCL2 TGCTGCTCCTGCTTCTAGTG TGGCTATGACTTCCGTTTGG 60 171 NM_001001861 [21]
GM-CSF GAAACCGTAGACGTCGTCTG GTGCTGCTCATAGTGCTTGG 62 150 DQ108393 [21]
HPRT1 GGACTTGAATCATGTTTGTG CAGATGTTTCCAAACTCAAC 60 91 DQ815175 [24]
IL1α CCCGTCAGGTCAATACCTC GCAACACGGGTTCGTCTTC 60 170 NM 214029 [43]
IL6 ATCAGGAGACCTGCTTGATG TGGTGGCTTTGTCTGGATTC 62 177 NM_214399 [43]
CXCL8 TCCTGCTTTCTGCAGCTCTC GGGTGGAAAGGTGTGGAATG 62 100 NM_213867 [21]
IL10 GGTTGCCAAGCCTTGTCAG AGGCACTCTTCACCTCCTC 60 202 NM_214041 [22]
RPL19 AACTCCCGTCAGCAGATCC AGTACCCTTCCGCTTACCG 60 147 AF435591 [21]
TBP-1 AACAGTTCAGTAGTTATGAGCCAGA AGATGTTCTCAAACGCTTCG 60 153 DQ845178 [24]
TGFβ GAAGCGCATCGAGGCCATTC GGCTCCGGTTCGACACTTTC 64 162 NM 214015 [21]
TLR4 TGTGCGTGTGAACACCAGAC AGGTGGCGTTCCTGAAACTC 62 136 NM_001113039 [21]
TLR2 ACGGACTGTGGTGCATGAAG GGACACGAAAGCGTCATAGC 62 101 NM_213761 [21]
TNFα CCAATGGCAGAGTGGGTATG TGAAGAGGACCTGGGAGTAG 62 116 X54859 [21]
  1. Reference genes are underlined