Skip to main content

Table 1 Primers used for real time quantitative polymerase chain reaction. List of gene sequences and primers (For: Forward; Rev: Reverse) used for real-time qPCR of immune-related genes

From: The fungal T-2 toxin alters the activation of primary macrophages induced by TLR-agonists resulting in a decrease of the inflammatory response in the pig

Oligo Names Medline mRNA Sequence Sequence 5′ → 3′ Reference
β2-microglobuline For β2-microglobuline Rev MN_213978 TTCTACCTTCTGGTCCACACTGA TCATCCAACCCAGATGCA [34]
RPL32 For RPL32 Rev MN_001001636 TGCTCTCAGACCCCTTGTGAAG TTTCCGCCAGTTCCGCTTA [32]
iNOS For iNOS Rev EST BI344008 GAGAGGCAGAGGCTTGAGAC TGGAGGAGCTGATGGAGTAG [30]
TLR2 For TLR2 Rev AB085935 TCACTTGTCTAACTTATCATCCTCTTG TCAGCGAAGGTGTCATTATTGC [33]
TLR4 For TLR4 Rev AB188301 GCCATCGCTGCTAACATCATC TCAGCGAAGGTGTCATTATTGC [33]
TLR6 For TLR6 Rev AB085936 AACCTACTGTCATAAGCCTTCATTC GTCTACCACAAATTCACTTTCTTCAG [33]
TLR7 For TLR7 Rev AB258453 CAGAAGTCCAAGTTTTTCCAGCTT GGTGAGCCTGTGGATTTGTTG [31]