Skip to main content

Table 1 Primers used in this study.

From: Immunohistochemical detection of piscine reovirus (PRV) in hearts of Atlantic salmon coincide with the course of heart and skeletal muscle inflammation (HSMI)

Primer names Primer sequence (5' → 3')
σ1 S1-F CACC ATGCATAGATTTACCCAAGAAGACCA
σ1 S1-R CTAGATGATGATCACGAAGTCTCCA
μ1 M2-F CACC ATGGGTAACTATCAGACAAGTAACAACCA
μ1 M2-R GGATCCCTATTTTTGGCCTCGACGTGAGT
μ1C M2-F CACC ATG CCTGGTGGTCACATGTATGTGATAT
  1. Overhangs for directional cloning are underlined. The introduced start codon is shown in bold.