Skip to main content

Table 1 PCR primer pairs, origin and features of apfA, apxA and tbpB genes and corresponding proteins

From: Type IV fimbrial subunit protein ApfA contributes to protection against porcine pleuropneumonia

Gene1 A. pleuropneumoniae
serotype
PCR primer pair (5' → 3')2 Gene length
(bps)
Protein MW
(kDa)3
apfA 7 CCGTCGAC ATGTCATATAACAGTTATAC
CCGCGGCCGC ATTTGATGCGCAGAAATTT
342 14
apxIA 1 GGGTCGAC ACGCTAACTCTCAGCTCGATA
GGGCGGCCGC AGCTGCTTGTGCTAAAGAA
3069 113
apxIIA 7 CCGTCGAC ACTCAAAAATCACTTTGTCATCA
CCGCGGCCGC AGCGGCTCTAGCTAATTG
2871 105
apxIIIA 2 GGGTCGAC ACAGTACTTGGTCAAGCATGTT
GGGCGGCCGC AGCTGCTCTAGCTAGGTTA
3159 115
apxIVA 3 CCGTCGAC ACACAAAATTAACTATGCAAGA
CCGCGGCCGC TAAAGCAGCTGTTAAGCTATT
5418 205
tbpB 7 CCGTCGAC ACTCTGGCGGAAAAGGAAGTT
CCGCGGCCGC TTTTTTTACTTGTTGTTTTGCA
1644 60
  1. 1Sequences of genes were acquired from GenBank (apfA, AY235719.1; apxIA, AF240779; apxIIA, CP001091; apxIIIA, L12145; apxIVA, AF030511; tbpB, U16017).
  2. 2All oligonucleotides were synthesized by Generi Biotech, Hradec Kralove, Czech Republic. First oligonucleotide represents forward PCR primer, second reverse PCR primer. Sal I and Not I recognition sites are marked in bold and underlined.
  3. 3The approximate protein molecular weight was calculated using the Compute pI/Mw tool (ExPASy).