Skip to main content

Table 2 Primer pairs developed in this study and variability of MLSA loci among 25 strains analysed

From: Multi-locus sequence analysis of mycoplasma capricolum subsp. capripneumoniae for the molecular epidemiology of contagious caprine pleuropneumonia

Locus Primer name Primer sequence (5'-3') Annealing T°
(°C)
Amplicona
(bp)
Locus sequence b
(bp)
Variable sites Sequence types
Loc-01 MLSA-Mccp-01-F GCTTATAGTGTTGTTGATACG 53 694 590 5 5
  MLSA-Mccp-01-R GCAATAATCAATTAGCACAG      
Loc-03 MLSA-Mccp-03-F ATTCCTCTCATTGAAGTTAC 47 765 664 7 7
  MLSA-Mccp-03-R TAGATTAAGAGTCACAATGC      
Loc-11 MLSA-Mccp-11-F TGATGGAATTATGTGTAGAGC 53 746 637 6 6
  MLSA-Mccp-11-R ATGAACGATCTTGATGTTCC      
Loc-12 MLSA-Mccp-12-F GGTATGGAGTTGATTTTGAAAC 58 742 646 4 4
  MLSA-Mccp-12-R GCTCCAGCTAAAGCATTATTA      
Loc-15 MLSA-Mccp-15-F GGACGAATTTATTTAGTTTCTGCTG 58 802 691 4 4
  MLSA-Mccp-15-R ACATTAGTTTGCATACCACCAGTAA      
Loc-17 MLSA-Mccp-17-F TAAACCAGAGCAAAACGGTA 58 751 649 8 6
  MLSA-Mccp-17-R AACACTAACAATTCCAACAGC      
Loc-20 MLSA-Mccp-20-F CTAGTTAATTTTGGAGCCGA 53 781 696 7 7
  MLSA-Mccp-20-R CATCAATTGTTGATGAATCG      
H2c N/A N/A N/A N/A 2174 12 8
8 concatenated loci N/A N/A N/A N/A 6747 53 15
  1. aAmplicon sizes in base pairs correspond to F38T amplifications
  2. bLocus sequence sizes in base pairs correspond to F38T data
  3. cFor information regarding H2 locus amplification and sequencing refer to [8]
  4. N/A: does not apply.