Skip to main content

Table 1 Oligonucleotide sequences, amplicon lengths, GenBank accession numbers and standard curve evaluation for qPCR assays.

From: Transcription of reference genes used for quantitative RT-PCR in Atlantic salmon is affected by viral infection

Gene Oligonucleotide sequence (5'-3') Amplicon (bp) GenBank acc. no Slope R2 Efficiency (E)*
EF1αB TGCCCCTCCAGGATGTCTAC 57 BG933897 3.460 0.979 1.94
  CACGGCCCACAGGTACTG      
  6FAM-AAATCGGCGGTATTGG-MGBNFQ      
RPS20 GCAGACCTTATCCGTGGAGCTA 85 BG93667 3.055 0.979 2.12
  TGGTGATGCGCAGAGTCTTG      
  6FAM-CCTCAAGGTGAAGGGA-MGBNFQ      
β-actin CCAAAGCCAACAGGGAGAAG 91 BG933897 3.173 0.996 2.06
  AGGGACAACACTGCCTGGAT      
  6FAM-TGACCCAGATCATGTTT-MGBNFQ      
18S rRNA CCCCGTAATTGGAATGAGTACACTTT 98 AJ427629 3.092 0.978 2.10
  ACGCTATTGGAGCTGGAATTACC      
  6FAM-CTTTAACGAGGATCCATTGG-MGBNFQ      
SPDV CCGGCCCTGAACCAGTT 107 AY604235    
  GTAGCCAAGTGGGAGAAAGCT      
  6FAM-CTGGCCACCACTTCGA-MGBNFQ      
  1. * The amplification efficiency of each primer set was assessed according to the equation E = 10(1/-slope).