Skip to main content

Table 1 Sequences of porcine-specific real-time PCR primersa.

From: Characterization of porcine dendritic cell response to Streptococcus suis

Name Accession Number Forward Reverse
TLR1 NM_001031775 CCAGTGTGTTGCCAATCGCTCATT TCCAGATTTACTGCGGTGCTGACT
TLR2 NM_213761 AGCACTTCCAGCCTCCCTTTAAGT TACTTGCACCACTCGCTCTTCACA
TLR4 NM_001113039 ACCAGACTTTCTTGCAGTGGGTCA AATGACGGCCTCGCTTATCTGACA
TLR6 NM_213760 TCCCAGAATAGGATGCAGTGCCTT ACTCCTTACATATGGGCAGGGCTT
PPIA NM_214353 AGGATTTATGTGCCAGGGTGGTGA ATTTGCCATGGACAAGATGCCAGG
  1. a Oligonucleotide primers were from Integrated DNA Technologies.