Skip to main content

Table 2 List of genes and sequences of the primers used for real-time PCR1.

From: Administration of probiotics influences F4 (K88)-positive enterotoxigenic Escherichia coli attachment and intestinal cytokine expression in weaned pigs

mRNA target Primers (5' → 3')2 Product size (bp) Final concentration (nM)3
IL-4 F:GGTCTGCTTACTGGCATGTACC 117 150
  R:CTCCATGCACGAGTTCTTTCTC   150
IL-6 F:GGAAATGTCGAGGCTGTGCAGATT 87 300
  R:GGTGGTGGCTTTGTCTGGATTCTT   300
IL-8 F:AGAACTGAGAAGCAACAACAACAG 132 300
  R:CACAGGAATGAGGCATAGATGTAG   300
IL-10 F:GATATCAAGGAGCACGTGAACTC 137 300
  R:GAGCTTGCTAAAGGCACTCTTC   300
IL-12p35 F:TGCAGGCTCTGAATTTCAAC 111 150
  R:CACGAATTCTGAAGGCATGA   150
IL-12p40 F:CTTCATCAGGGACATCATCAAAC 196 300
  R:GGTCCGTGAAGAGTTTATCTTTCT   150
IFN-γ F:AGGTTCCTAAATGGTAGCTCTGGG 101 300
  R:AGTTCACTGATGGCTTTGCGCT   300
TNF-α F:CACTGACCACCACCAAGAATTGGA 94 300
  R:CATTCCAGATGTCCCAGGTTGCAT   300
pBD-2 F:CCGACCACTACATATGTGCCAAGA 93 300
  R:TGCCACTGTAACAGGTCCCTTCAA   300
COX-2 F: AAGCGAGGACCAGCTTTCACCAAA 93 300
  R:GCGCAGTTTATGCTGTCTCTCCAA   300
ACTB F:CTCTTCCAGCCCTCCTTCCT 104 300
  R:GCGTAGAGGTCCTTCCTGATGT   300
  1. 1IL = interleukin; IFN = interferon; TNF = tumor necrosis factor; pBD-2 = porcine β-defensin-2; COX-2 = cyclooxygenase-2; ACTB = β-actin.
  2. 2F and R indicate forward and reverse primers, respectively.
  3. 3Final concentration of forward (F) and reverse (R) primers.