Skip to main content

Table 2 Toll-like receptor primers.

From: Induction of inflammatory cytokines and toll-like receptors in chickens infected with avian H9N2 influenza virus

Toll-like receptors Forward Primer Reverse Primer
TLR-1 2199F- GCTGTGTCAGCATGAGAGGA 2436R-GTG GTACCTCGCAGGGATAA
TLR-2 421F-GAA AGTTCCCCCTTTTCCAG 666R-AGAGTGCAGAAGGTCCCTGA
TLR-3 1256F-CCTCCTTGGGACACCTGA AA 1494R-ATTCCGCAGTGGATGAAAAG
TLR-4 2624F-GCTGGGCAA AGTGAA AAGAG 2846R-TAAGAACAGCCCGTTCATCC
TLR-5 202F-CCACTGCTGGAGGATTTGTT 416R-TCCAGGATGGAATCTCCA AG
TLR-7 2978F- AGAGACTGGCTTCCAGGACA 3196R- CAGCTGAACATACCGGGACT
TLR-15 893F-CCATCAACAGCCTGGAAACT 1129R-CCTGGTTTCTGACCAAGGAA