Skip to main content

Table 1 Primers used to produce PCV-2 DNA clones

From: Modification of PCV-2 virulence by substitution of the genogroup motif of the capsid protein

Primer name Primer sequence 5'-3' Primer purpose
PCV-2a short forward AAGTATTACCAGCGCACTTC Amplification
PCV-2a short reverse ACCATTACGAAGTGATAAAA Amplification
PCV-2a long forward CCATGCCCTGAATTTCCATA Amplification
PCV-2a long reverse CCGTGGATTGTTCTGTAGCA Amplification
PCV-2b forward ACAACGGAGTGACCTGTCTA Amplification
PCV-2b reverse ACCATTACGAAGTGATAAAA Amplification
PCV-2a/(SNPISI) forward CCCCGGGAGGGGGGAG CAACCC AATCTCTATACCCTTT Mutation
PCV-2a/(SNPISI) reverse AAAGGGTATAGAGATTGG GTTGC TCCCCCCTCCCGGGG Mutation
PCV-2a/motif 2b forward GGGAGGGGGGAGCAACCCAAGG TCTG TACCCTTTGAATAC Mutation
PCV-2a/motif 2b reverse GTATTCAAAGGGTAC AGACC TTGGGTTGCTCCCCCCTCCC Mutation
PCV-2b/(TNKRSV) forward CTTCCCCCAGGAGGGGGCA CG AACAAG CGCTCTGTGCCCTTTGAA Mutation
PCV-2b/(TNKRSV) reverse TTCAAAGGGCACAGAGCGCTT GTTC GT GCCCCCTCCTGGGGGAAG Mutation
PCV-2b/motif 2a forward CCCAGGAGGGGGCACGAACAAGAT CTCTA TA CCCTTTGAATACTACAGAATAA Mutation
PCV-2b/motif 2a reverse TTATTCTGTAGTATTCAAAGGGT AT AGAGAT CTTGTTCGTGCCCCCTCCTGGG Mutation
  1. Mutations introduced in the primers are in bold and underlined.