Skip to main content

Table 1 Primers used in this study

From: Recovery of infectious virus from full-length cowpox virus (CPXV) DNA cloned as a bacterial artificial chromosome (BAC)

Oligo # Sequence 5'-3' Comments
oligo #046 forward TCCTTAATTAAGACAACTCAAACATCTGCGTTATC  
oligo #047 reverse TCCTTAATTAAGCAGTACTAGGTTCATTTCCTCCT  
oligo #048 forward TTTAAAGGCCGGCC ACAGTTCTTTCCAGACATTGTTGA Fse I site underlined
oligo #049 reverse TTTAAAGGCCGGCC TTCATCGATACCTATCACGG Fse I site underlined
oligo #237 forward GAGCCCACGTTTAAACATTCTT  
oligo #238 reverse GGTAACATAATACCCTTTTCCTGAA mini-F
oligo #239 forward TCGTATGTTGTGTGGAATTGTGA mini-F
oligo #240 reverse ACCGTGTGGAATATAAAAGTCCT  
oligo #264 reverse CGATAATAGATACGGAACGGGAC TK
oligo #265 forward TTACGTTGAAATGTCCCATCAA TK