Skip to main content

Table 1 Primer sequences as used in the PCR.

From: Highly pathogenic or low pathogenic avian influenza virus subtype H7N1 infection in chicken lungs: small differences in general acute responses

RNA target Primers Primer sequence (5'-3') Target accession number
IFN-γ IFN-γ For IFN-γ Rev TTCGATGTACTTGGAAATGC TTGCATCTCCTCTGAGACTG Y07922
28S 28S For 28S Rev CAAGTCCTTCTGATCGAG TCAACTTTCCCTTACGGTAC DQ018756
IFN-β IFN-β For IFN-β Rev CAGCTCTCACCACCACCTTCTC GGAGGTGGAGCCGTATTCTG AY974089
IFN-α IFN-α For IFN-α Rev TTCAGCTGCCTCCACACCTT TTGTGGATGTGCAGGAACCA AB255630
IL-6 IL-6 For IL-6 Rev AGGACGAGATGTGCAAGAAG TGCTGTAGCACAGAGACTCG EU170468
IL-8 IL-8 For IL-8 Rev ATTCAAGATGTGAAGCTGAC AGGATCTGCAATTAACATGAGG DQ393272.2
IL-1β IL-1β For IL-1β Rev CAGCACCTCAGCGAAGAG CTGTGGTGTGCTCAGAATCCA DQ393267.1